Suchergebnisse
Results list
Non-Binary Environmental Archive Data (NEAD) format
Important note: From 2025 the NEAD format is being transformed into the interoperable CSV (iCSV) format, a formalized and standardized evolution of the NEAD format. Furthermore, iCSV should be backwards compatible with NEAD. More information on the new iCSV format will be linked here in due time. Acknowledgement: The NEAD format includes NetCDF metadata and is proudly inspired by both SMET and NetCDF formats. NEAD is designed as a long-term data preservation and exchange format. The NEAD specifications were presented at the "WMO Data Conference 2020 - Earth System Data Exchange in the 21st Century" (Virtual Conference). ----------------------- Summary: The Non-Binary Environmental Data Archive (NEAD) format is being developed as a generic and intuitive format that combines the self-documenting features of NetCDF with human readable and writeable features of CSV. It is designed for exchange and preservation of time series data in environmental data repositories. License: The NEAD specifications are released to the public domain under a Creative Commons CC0 "No Rights Reserved" international license. You can reuse the information contained herein in any way you want, for any purposes and without restrictions.
Simulation parameters and outputs for a rigorous approach to the specific surface area evolution in snow during temperature gradient metamorphism
In the associated study [1], two time-lapse temperature gradient metamorphism series of three-dimensional micro-computed tomography images of snow (obtained by [2]) have been used to model the decrease of specific surface area (SSA) over time based on the pore-scale physics. We conducted finite element simulations of one-way coupled heat and mass diffusion in order to estimation the spatial pattern of water vapor deposition and sublimation, which controls the evolution of the SSA over time. We notably studied the influence of the condensation coefficient, a key but poorly constrained physical parameter. This dataset provides the parameters used for the mesh generation and the finite element simulations. It also includes the ice fraction, specific surface area per unit volume and surface average of mean curvature and vapor field obtained as outputs from the mesh process and the simulations. [1]: Braun, A., Fourteau, K., and Löwe, H.: A rigorous approach to the specific surface area evolution in snow during temperature gradient metamorphism, EGUsphere [preprint], https://doi.org/10.5194/egusphere-2023-1947, 2023. [2]: Pinzer, B. R., Schneebeli, M., and Kaempfer, T. U.: Vapor flux and recrystallization during dry snow metamorphism under a steady temperature gradient as observed by time-lapse micro-tomography, The Cryosphere, 6, 1141–1155, https://doi.org/10.5194/tc-6-1141-2012, 2012.
COSMO-WRF Dataset for Swiss Alps Simulations in Gray-Zone Resolution
This dataset contains simulation data for *"Influence of Air Flow Features on Alpine Wind Energy Potential" (Kristianti et al., 2024).* • The WRF_dia2702 and WRF_dia1103 folders contain the namelist.wps, namelist.input, and output files from the simulation in the Diablerets region on 27/02/2021 and 11/03/2021, respectively. • The WRF_luk2310 and WRF_luk0912 folders contain the namelist.wps, namelist.input, and output files from the simulation in the Lukmanier region on 23/10/2020 and 09/12/2020, respectively. • The postprocessing file contains Python codes used to create figures in Kristianti et al. (2024). **Notes:** • Topography input is provided by Gerber et al. (2021). • Simulations are run using the COSMO-WRF model developed by Gerber et al. (2018). • Visualization by Python code uses wrf-python provided by Ladwig et al. (2017). *This dataset was produced by the EDGE consortium sponsored by the Swiss Federal Office of Energy's SWEET programme, Swiss National Science Foundation (SNSF): Grant 179130, and the Swiss National Supercomputing Centre (CSCS) projects s938, s1115 and s1242.*
Monitoring data sets of alpine photovoltaic power-plants
On this repository you can find the monitoring data of the 3 PV power-plants analysed in the article _"Confirmation of the power gain for solar photovoltaic systems in alpine areas"_ (doi: 10.3389/fenrg.2024.1372680) . Each folder contains the following two elements: 1. **README.txt** : describes the content of the folder. Especially it describes the plant's monitoring system's architecture and relates it to the various files included in the data sub-folder. It also provides a detailed description of all processing steps leading to the data sets as available in the data sub-folder and used in the pre-cited article. 3. **data/** : sub-folder containing the file(s) used in the referenced article.
FACE: Stillberg CO2 enrichment and soil warming study
Background information High elevation ecosystems are important in research about environmental change because shifts in climate associated with anthropogenic greenhouse gas emissions are predicted to be more pronounced in these areas compared to most other regions of the world. This project involved a Free Air CO2 Enrichment (FACE) and soil warming experiment located in a natural treeline environment near Davos, Switzerland (Stillberg, 2200 m a.s.l.). Elevated atmospheric CO2 concentrations (+200 ppm) were applied from 2001 until 2009, and a soil warming treatment (+4 °C) was applied from 2007 until 2012. The combined CO2 enrichment and warming treatment reflects conditions expected to occur in this region in approximately 2050. A broad range of ecological and biogeochemical research was carried out as part of this environmental change project. Experimental design The experiment consisted of 40 hexagonal 1.1 m² plots, 20 with a *Pinus mugo* ssp. *uncinata* (mountain pine, evergreen) individual in the centre and 20 with a *Larix decidua* (European larch, deciduous) individual in the centre. A dense cover of understorey vegetation surrounded the tree in each plot, including the dominant dwarf shrub species *Vaccinium myrtillus* (bilberry), *Vaccinium gaultherioides* (group *V. uliginosum agg.*, northern bilberry) and *Empetrum nigrum* ssp. *hermaphroditum* (crowberry) plus several herbaceous and non-vascular species. At the beginning of the experimental period, the 40 plots were assigned to ten groups of four neighbouring plots (two larch and two pine trees per group) in order to facilitate the logistics of CO2 distribution and regulation. Half of these groups were randomly assigned to an elevated CO2 treatment, while the remaining groups served as controls and received no additional CO2. In spring 2007, one plot of each tree species identity was randomly selected from each of the 10 CO2 treatment groups and assigned a soil warming treatment, yielding a balanced design with a replication of five individual plots for each combination of CO2 level, warming treatment and tree species. Data description Soil and air conditions have been monitored closely throughout the study period, with most measurements made during the combined CO2 x warming experiment (2007-2009). The data comprise of air temperature, soil temperature, soil moisture, sapflow, tree diameter and CO2 measurements.
A grain-size driven transition in the deformation mechanism in slow snow compression
We conducted consecutive loading-relaxation experiments at low strain rates to study the viscoplastic behavior of the intact ice matrix in snow. The experiments were conducted using a micro-compression stage within the X-ray tomography scanner in the SLF cold laboratory. Next, to evaluate the experiments, a novel, implicit solution of a transient scalar model was developed to estimate the stress exponent and time scales in the effective creep relation (Glen's law). The result reveals that, for the first time, a transition in the exponent in Glen's law depends on geometrical grain size. A cross-over of stress exponent $n=1.9$ for fine grains to $n=4.4$ for coarse grains is interpreted as a transition from grain boundary sliding to dislocation creep. The dataset includes compression force data from 11 experiments and corresponding 3D image data from tomography scans.
Native and no-native plant interactions in Australian grasslands
This dataset contains all data, on which the following publication below is based. Paper Citation: _Schlierenzauer, C., Risch, A.C., Schütz, M., Firn, J. 2021. Non-native Eragrostis curvula reduces plant species diversity in pastures of South-eastern Australia even when native Themeda triandra remains co-dominant. Plants 10, 596._ Please cite this paper together with the citation for the datafile. Study area The study was conducted in the lowland grassy woodlands of the Bega Valley Region, which is located in the south-east corner of New South Wales, Australia. Embedded between the Pacific Ocean and the Australian Alps, the lowland grassy woodlands are mostly located on granitic substrates and reach elevations of roughly 500 m above sea level. Typically, these grassy woodlands receive less precipitation (mean annual precipitation between 700-1100 mm) compared to the more elevated areas that surround them (NSW Government - Office of Environment and Heritage 2017). The vegetation is dominated by an open tree canopy layer consisting of Eucalyptus tereticornis Sm, Angophora floribunda Sm. (Sweet) and a range of other eucalypt species. Sometimes shrub or small trees are also present, whereas grasses and forbs form the ground-cover. In areas without intensive agricultural history, this layer is dominated by perennial, tussock grasses such as Themeda triandra Forssk, Microlaena stipoides R.Br (Weeping Grass), Eragrostis leptostachya Steud. (Paddock Lovegrass) and Echinopogon ovatus P.Beauv (Forest Hedgehog Grass). The remaining inter-tussock spaces are occupied by a diversity of growth-restricted grasses and herbaceous forbs (NSW - Department of Planing, Industries and Environment 2019; NSW Government - Office of Environment and Heritage 2017). Clearing, pasture sowing, fertilizer application and livestock grazing resulted in a dramatic decrease in the extent of these natural woodlands, with less than five percent within conservation reserves and overall, with only about 20% of their original extent in New South Wales still existing (Tozer et al. 2010). The remaining areas outside of reserves are threatened by altered fire frequencies, habitat clearing, livestock grazing and especially by non-native plant invasion, particularly Eragrostis curvula (Schrad.) Nees. For this reason, the grassy woodlands are listed as an endangered ecological community in the NSW state legislation. Additionally, they are considered as critically endangered by the Commonwealth of Australia (Threatened Species Scientific Committee (TSSC) 2013). Experimental design and sampling The study was conducted on six farms and in each of them two sites were chosen, representing a paired design. One of the sites at each farm is dominated by native Themeda triandra, the other one co-dominated by non-native Eragrostis curvula and Themeda triandra. All farms are within a radius of approximately 10 km from the town Candelo. Three of the farms are located North (36°40’ to 36°42’ S and 149°38’ to 149°42’ E) and three of them are located South (36°51’ to 36°49’ S and 149°38’ to 149°42’ E) of Candelo. Non-native herbivores (mainly cattle, sheep and rabbits) and native herbivorous marsupials (mainly kangaroos, wallabies and wombats) are present in the area of these sites. On each site, data was collected within four plots (each 1 x 1 m) in May and November 2020. All plant species found within a plot were recorded and their relative abundance was estimated. References NSW - Department of Planing, Industries and Environment. 2019. “Lowland Grassy Woodland in the South East Corner Bioregion - Endangered Ecological Community Listing.” https://www.environment.nsw.gov.au/topics/animals-and-plants/threatened-species/nsw-threatened-species-scientific-committee/determinations/final-determinations/2004-2007/lowland-grassy-woodland-south-east-corner-bioregion-endangered-ecological-community-l (February 18, 2021). NSW Government - Office of Environment and Heritage. 2017. “Lowland Grassy Woodland in the South East Corner Bioregion - Profile.” https://www.environment.nsw.gov.au/threatenedSpeciesApp/profile.aspx?id=20070 (January 31, 2021). Threatened Species Scientific Committee (TSSC). 2013. Environment Protection and Biodiversity Conservation Act 1999 (EPBC Act) Conservation Advice for Lowland Grassy Woodland in the South East Corner Bioregion. http://www.environment.gov.au/biodiversity/threatened/communities/pubs/82-conservation-advice.pdf. Tozer, Mark et al. 2010. “Native Vegetation of Southeast NSW: A Revised Classification and Map for the Coast and Eastern Tablelands.” Cunninghamia : a journal of plant ecology for eastern Australia 11(3): 359–406.
Long-term afforestation experiment at the Alpine treeline site Stillberg, Switzerland
Background information The Stillberg ecological treeline research site in the Swiss Alps was established in 1975, with the aim to develop ecologically, technically, and economically sustainable reforestation techniques at the treeline to reduce the risk of snow avalanches. In the course of time, additional research aspects gained importance, such as the ecology of the treeline ecotone under global change. Long-term monitoring of the large-scale high-elevation afforestation has generated data about tree growth, survival, and vitality. In addition, detailed characteristics of the microsite conditions of the research were conducted. Besides providing a scientific basis and practical guidelines for high-elevation afforestation, this research has contributed to a comprehensive understanding of ecological processes in the treeline ecotone. Experiment description The Stillberg afforestation experiment was established in 1975 by planting 92,000 seedlings of *Larix decidua*, *Pinus cembra* and *Pinus mugo* ssp. *uncinata* in the alpine treeline ecotone. The afforestation site is located on a northeast-facing slope with steep, topographically highly structured terrain and covers elevations from 2075 to 2230 m a.s.l. The afforestation site was divided into 4052 square plots of 3.5 × 3.5 m, arranged in a regular species-alternating pattern over the whole area. Each plot contained 25 trees of one species (1350 plots per species), and the seedlings were systematically planted 70 cm apart. The trees have been monitored since 1975. Specifically, tree mortality was assessed annually from 1975 until 1995 and has been documented every ten years since then, with surveys in 2005 and 2015 (the next survey is due in 2025). Height of the surviving trees was measured in 1975, 1979, 1982, 1985, 1990, 1995, 2005, and 2015. In 1995, 2005, and 2015, drivers of tree vitality were assessed for a subset of trees per plot. Additionally, an extensive set of environmental parameters characterizing microsite conditions of the afforestation area were recorded before and after the planting of the trees. Data description The five datasets from the afforestation experiment comprise ecological and environmental data from the main afforestation experiment in five datasets with accompanying metadata (Stillberg_afforestation_all_metadata.xlsx). All data and metadata files are bundled in a ZIP-file (Stillberg_afforestation_v1.zip). In particular, a first dataset contains environmental data characterising microsite conditions of the 4000 plots with regard to soil, topography, vegetation and microclimatic conditions (Stillberg_afforestation_plot_data_v1.csv; Stillberg_afforestation_plot_metadata_v1.csv. In each plot, the natural tree regeneration was assessed by counting seedings of several tree species in 2005 and 2015 (Stillberg_afforestation_regeneration_data_v1.csv; Stillberg_afforestation_regeneration_metadata_v1.csv). Furthermore, specific information about each of the 92’000 planted trees of the tree species is available (Stillberg_afforestation_tree_parameter_data_v1.csv; Stillberg_afforestation_tree_parameter_metadata_v1.csv). Survival data for each of the 92’000 individual trees can be found in a separate dataset (Stillberg_afforestation_tree_survival_data_v1.csv; Stillberg_afforestation_tree_survival_metadata_v1.csv). Tree growth and vitality parameters are available for all trees from 1995, and for subsets of trees for 2005 and 2015 (Stillberg_afforestation_tree_measurements_data_v1.csv; Stillberg_afforestation_tree_measurements_metadata_v1.csv).
CHELSAch-highres-climatologies at high resolution
CHELSA is a mechanistic downscaling model that links large-scale atmospheric conditions with local topographic factors to produce very high-resolution climate data. It includes commonly used climate variables for impact modeling, such as air temperature, precipitation, humidity, solar radiation, wind speed, and derived variables. CHELSAch-highres-climatologies is a high resolution climate dataset generated with the CHELSA downscaling model. It consists of long term - 30 year mean aggregated surface variables. Climatological summaries are provided for: Near-Surface Wind Speed, Daily Mean Near-Surface Air Temperature, Daily Maximum Near-Surface Air Temperature, Daily Minimum Near-Surface Air Temperature. Air Temperature Lapse Rate, Total Cloud Cover Percentage, Precipitation, Surface Downwelling Shortwave Flux in Air Files are provided in NetCDF format with standardized metadata.
Environmental DNA Freshwater Switzerland VaudCatchment Modipl 2020
Catchment-based sampling of river eDNA integrates terrestrial and aquatic biodiversity of alpine landscapes From 22-Jun-2020 to 26-Jun-2020, we sampled five sites comprising one low, two intermediate and two high-elevation sites per catchment (Fig. 1a). We visited two catchments per day—one in the morning and one in the afternoon—for a total of ten catchments. All samples per catchment were collected within a maximum four-hour period by three groups of samplers. The intermediate and high-elevation sites were situated along two tributaries leading into the low-elevation site of the river. We used three filters for each relative elevation class and filtered 60 L per relative elevation class. We sampled 30 L per tributary for a combined volume of 60 L at the intermediate and high-elevation sites. In total, 180 L were sampled in total per catchment. A filtration device composed of either the Athena® peristaltic pump (Proactive Environmental Products LLC; 1 L/min nominal flow) or the Subspace® underwater peristaltic pump (Subspace Pictures; 1 L/min nominal flow), combined with a VigiDNA® 0.2 µM cross-flow filtration capsule (VigiDNA, SPYGEN) was used in order to filter a large water volume. We used a finer mesh than the recommended VigiDNA® 0.45 µM cross-flow filtration capsule to maximise the capture of biological material since mountain water does not transport high quantities of sediments. For each filtration capsule, we used disposable sterile tubing. At the end of each filtration, we emptied the water inside the capsules, replaced it with 80 ml of CL1 conservation buffer (SPYGEN), and stored it at room temperature. We followed a strict contamination control protocol in both field and laboratory stages (Goldberg et al. 2016; Valentini et al. 2016). Each water sample was processed using disposable gloves and single-use filtration equipment. We used two primer sets targeting vertebrates (Vert01, forward: − TTAGATACCCCACTATGC, reverse: − TAGAACAGGCTCCTCTAG, mean marker length: 97 bp) and spermatophytes (g-h/Sper01, forward: − GGGCAATCCTGAGCCAA, reverse: CCATTGAGTCTCTGCACCTATC, mean marker length: 48 bp). Though both primers are relatively broad with low species-level resolution, we selected them as the goal was to minimise cost and effort and maximise the identification of a broad range of taxa which can represent the species assemblages of the region. Libraries were prepared with ligation using the MetaFast protocol (Fasteris).